SBOL XML format (.xml) sequence files

SBOL (Synthetic Biology Open Language) XML format sequence files are the XML serialization of SBOL. They can contain one or more DNA sequences each. Sequence annotations within SBOL XML format files are extremely useful for being able to view a DNA sequence at a higher/more functional level, and allow for rapidly checking if a designed DNA assembly process will result in the desired sequence. More than anything, the utility of SBOL XML files is for interoperation with emerging Synthetic Biology software tools.

Currently, the "displayId" field for a given DnaComponent is used to determine if two DnaComponents (with the same name/label) should be spliced at a DNA assembly junction.

Here is a stylized example SBOL XML format file:

<?xml version="1.0" encoding="UTF-8" ?>
<rdf:RDF xmlns="http://sbols.org/v1#" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" 
xmlns:rdfs="http://www.w3.org/2000/01/rdf-schema#" xmlns:so="http://purl.obolibrary.org/obo/">
  <DnaComponent rdf:about="http://j5.jbei.org/dc#97A98D05-96EF-489F-B338-0B30B1AB59BC">
    <displayId>signal_pep</displayId>
    <dnaSequence>
      <DnaSequence rdf:about="http://j5.jbei.org/ds#172ECA24-1557-4870-939E-D7C699B09170">
        <nucleotides>ggcagcaaggtctacggcaaggaacagtttttgcggatgcgccagagcatgttccccgatcgc</nucleotides>
      </DnaSequence>
    </dnaSequence>
    <annotation>
      <SequenceAnnotation rdf:about="http://j5.jbei.org/sa#7B75111D-08BC-4FB9-AA59-03EDFEFC314E">
        <bioStart>1</bioStart>
        <bioEnd>63</bioEnd>
        <strand>+</strand>
        <subComponent>
          <DnaComponent rdf:about="http://j5.jbei.org/dc#43FB4AC0-217C-49D1-9E65-01F5332177F8">
            <rdf:type rdf:resource="http://purl.obolibrary.org/obo/SO_0000316" />
            <displayId>signal_peptide</displayId>
          </DnaComponent>
        </subComponent>
      </SequenceAnnotation>
    </annotation>
  </DnaComponent>
</rdf:RDF>

Here is the actual SBOL XML format sequence file: signal_peptide_SBOL.xml

For the sake of comparison, here is the equivalent Genbank format file:

LOCUS       signal_pep                63 bp ds-DNA     linear       26-MAR-2011
ACCESSION   
VERSION     
KEYWORDS    .
FEATURES             Location/Qualifiers
     CDS             1..63
                     /label="signal_peptide"
                     /translation="GSKVYGKEQFLRMRQSMFPDR"
ORIGIN      
        1 ggcagcaagg tctacggcaa ggaacagttt ttgcggatgc gccagagcat gttccccgat
       61 cgc     
//

Here is the actual Genbank format file: signal_peptide.gb

Here is the stylized schema for the SBOL XML sequence format:

<?xml version="1.0" encoding="UTF-8"?>
<!--
  Copyright (c) 2012 Clark & Parsia, LLC. <http://www.clarkparsia.com>

  Licensed under the Apache License, Version 2.0 (the "License");
  you may not use this file except in compliance with the License.
  You may obtain a copy of the License at
  http://www.apache.org/licenses/LICENSE-2.0

  Unless required by applicable law or agreed to in writing, software
  distributed under the License is distributed on an "AS IS" BASIS,
  WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
  See the License for the specific language governing permissions and
  limitations under the License.
--> 

<xsd:schema targetNamespace="http://sbols.org/v1#" elementFormDefault="qualified" attributeFormDefault="qualified"
   xmlns="http://sbols.org/v1#" xmlns:xsd="http://www.w3.org/2001/XMLSchema" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#"
   xmlns:dc="http://purl.org/dc/elements/1.1/"
   version="0.3">

   <xsd:import namespace="http://www.w3.org/1999/02/22-rdf-syntax-ns#" schemaLocation="rdf.xsd"/>    

   <xsd:annotation>
      <xsd:documentation>
         XML Schema for SBOL core data model that is compatible with RDF/XML serialization.
         <dc:date>2012-01-19</dc:date>
         <dc:creator>Evren Sirin</dc:creator>
         <dc:contributor>Michal Galdzicki</dc:contributor>
      </xsd:documentation>
   </xsd:annotation>

   <xsd:group id="SBOLTopLevelType" name="SBOLTopLevelType">
      <xsd:annotation>
         <xsd:documentation>
            Top level SBOL types that are allowed to occur as the children of root RDF document.  
         </xsd:documentation>
      </xsd:annotation>
      <xsd:choice>
         <xsd:element name="Collection" type="CollectionType"/>
         <xsd:element name="DnaComponent" type="DnaComponentType"/>
         <xsd:element name="DnaSequence" type="DnaSequenceType"/>
      </xsd:choice>
   </xsd:group>

   <xsd:complexType name="CollectionType">
      <xsd:annotation>
         <xsd:documentation>
            Collection type from SBOL core data model. Additional elements from other namespaces can be added
            at the end of the element's children.
         </xsd:documentation>
      </xsd:annotation>   
      <xsd:sequence>
         <xsd:element name="displayId" type="DisplayIdType" minOccurs="1" maxOccurs="1"/>
         <xsd:element name="name" type="NameType" minOccurs="0" maxOccurs="1"/>                
         <xsd:element name="description" type="DescriptionType" minOccurs="0" maxOccurs="1"/> 
         <xsd:element name="component" minOccurs="0" maxOccurs="unbounded">
             <xsd:complexType>
               <xsd:sequence>
                  <xsd:element name="DnaComponent" type="DnaComponentType" minOccurs="1" maxOccurs="1"/>
               </xsd:sequence>
            </xsd:complexType>
         </xsd:element>        
         <xsd:any namespace="##other" processContents="skip" minOccurs="0" maxOccurs="unbounded"/>
      </xsd:sequence>
      <xsd:attribute ref="rdf:about" use="required"/>
   </xsd:complexType>

   <xsd:complexType name="DnaComponentType">
      <xsd:annotation>
         <xsd:documentation>
            DnaComponent type from SBOL core data model. Only displayId element is required for this
            element; all the other elements are optional.
         </xsd:documentation>
      </xsd:annotation>    
      <xsd:sequence>
         <xsd:group ref="rdf:SequenceOntologyType" minOccurs="0" maxOccurs="unbounded"/> 
         <xsd:element name="displayId" type="DisplayIdType" minOccurs="1" maxOccurs="1"/>
         <xsd:element name="name" type="NameType" minOccurs="0" maxOccurs="1"/>
         <xsd:element name="description" type="DescriptionType" minOccurs="0" maxOccurs="1"/>
         <xsd:element name="dnaSequence" minOccurs="0" maxOccurs="1">
            <xsd:complexType>
               <xsd:sequence>
                  <xsd:element name="DnaSequence" type="DnaSequenceType" minOccurs="1" maxOccurs="1"/>
               </xsd:sequence>
            </xsd:complexType>
         </xsd:element>
         <xsd:element name="annotation" minOccurs="0" maxOccurs="unbounded">
            <xsd:complexType>
               <xsd:sequence>
                  <xsd:element name="SequenceAnnotation" type="SequenceAnnotationType" minOccurs="1" maxOccurs="1"/>
               </xsd:sequence>
            </xsd:complexType>
         </xsd:element>
         <xsd:any namespace="##other" processContents="skip" minOccurs="0" maxOccurs="unbounded"/>
      </xsd:sequence>
      <xsd:attribute ref="rdf:about" use="required"/>
   </xsd:complexType>

   <xsd:complexType name="DnaSequenceType">
      <xsd:annotation>
         <xsd:documentation>
            DnaSequence type from SBOL core data model. The nucleotides element is required.
         </xsd:documentation>
      </xsd:annotation>
      <xsd:sequence>
         <xsd:element name="nucleotides" minOccurs="1" maxOccurs="1" type="NucleotideType"/>
         <xsd:any namespace="##other" processContents="skip" minOccurs="0" maxOccurs="unbounded"/>
      </xsd:sequence>
      <xsd:attribute ref="rdf:about" use="required"/>
   </xsd:complexType>

   <xsd:complexType name="SequenceAnnotationType">
      <xsd:annotation>
         <xsd:documentation>
            SequenceAnnotation type from SBOL core data model. The subComponent element is required. Other 
            elements are optional.
         </xsd:documentation>
      </xsd:annotation>   
      <xsd:sequence>
         <xsd:element name="precedes" type="rdf:Reference" minOccurs="0" maxOccurs="unbounded"/>
         <xsd:group ref="BioStartBioEndGroup" minOccurs="0" maxOccurs="1"/>
         <xsd:element name="strand" type="StrandType" minOccurs="0"/>
         <xsd:element name="subComponent" minOccurs="1" maxOccurs="1">
            <xsd:complexType>
               <xsd:sequence>
                  <xsd:element name="DnaComponent" type="DnaComponentType" minOccurs="1" maxOccurs="1"/>
               </xsd:sequence>
            </xsd:complexType>
         </xsd:element>   
         <xsd:any namespace="##other" processContents="skip" minOccurs="0" maxOccurs="unbounded"/>
      </xsd:sequence>
      <xsd:attribute ref="rdf:about" use="required"/>
   </xsd:complexType>

   <xsd:group name="BioStartBioEndGroup">
      <xsd:annotation>
         <xsd:documentation>
            The start and end coordinates are optional but if they exist, they should exist together so
            they are defined together in a group.
         </xsd:documentation>
      </xsd:annotation>    
      <xsd:sequence>
         <xsd:element name="bioStart" type="xsd:positiveInteger" minOccurs="1" maxOccurs="1"/>
         <xsd:element name="bioEnd" type="xsd:positiveInteger" minOccurs="1" maxOccurs="1"/>
      </xsd:sequence>
   </xsd:group>

   <xsd:simpleType name="DisplayIdType">
      <xsd:restriction base="xsd:string"/>
   </xsd:simpleType>

   <xsd:simpleType name="NameType">
      <xsd:restriction base="xsd:string"/>
   </xsd:simpleType>

   <xsd:simpleType name="DescriptionType">
      <xsd:restriction base="xsd:string"/>
   </xsd:simpleType>

   <xsd:simpleType name="StrandType">
      <xsd:restriction base="xsd:string">
         <xsd:enumeration value="+"/>
         <xsd:enumeration value="-"/>
      </xsd:restriction>
   </xsd:simpleType>

   <xsd:simpleType name="NucleotideType">
      <xsd:restriction base="xsd:string">
         <xsd:pattern value="[acgtrykmswbdhvn]+"/>
         <xsd:minLength value="1"/>
      </xsd:restriction>
   </xsd:simpleType>

</xsd:schema>

Here is the actual schema for the SBOL XML format sequence file: sbol.xsd